You Learn Something New Every Day :/ Fuck

you learn something new every day :/ fuck

The orphans of London can rest safe knowing that they are no longer at risk of being harvested for organs to keep Phillip alive

More Posts from Quinn-loves-liam and Others

3 years ago

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

4 years ago

he's stolen your romance movies i 100% guarantee it and replaced them with copy's of the lego bat man video game for xbox 360 @lordmoreau

i want you to hug @big-dicked-heisenberg and then tease him for secretly liking romance movies, he might deny it but he loves them.

No! I would never do that to Karl! He’s my best friend and my big bro!

4 years ago
Epithet Erased Is REALLY Good Guys. I Love The Rat Man.
Epithet Erased Is REALLY Good Guys. I Love The Rat Man.
Epithet Erased Is REALLY Good Guys. I Love The Rat Man.
Epithet Erased Is REALLY Good Guys. I Love The Rat Man.

Epithet Erased is REALLY good guys. I love the rat man.

4 years ago
I Will Never Shut Up About How Attractive Neil Is, And That's Final 🧎‍♀️
I Will Never Shut Up About How Attractive Neil Is, And That's Final 🧎‍♀️
I Will Never Shut Up About How Attractive Neil Is, And That's Final 🧎‍♀️
I Will Never Shut Up About How Attractive Neil Is, And That's Final 🧎‍♀️

I will never shut up about how attractive Neil is, and that's final 🧎‍♀️

1 year ago

Tumbleweed at all times looks like he's pouting, I can't help but laugh at him just a little

Tumbleweed At All Times Looks Like He's Pouting, I Can't Help But Laugh At Him Just A Little
Tumbleweed At All Times Looks Like He's Pouting, I Can't Help But Laugh At Him Just A Little
Tumbleweed At All Times Looks Like He's Pouting, I Can't Help But Laugh At Him Just A Little
Tumbleweed At All Times Looks Like He's Pouting, I Can't Help But Laugh At Him Just A Little
Tumbleweed At All Times Looks Like He's Pouting, I Can't Help But Laugh At Him Just A Little

And my favorite even though it's blurry

Tumbleweed At All Times Looks Like He's Pouting, I Can't Help But Laugh At Him Just A Little

Ahdjsjdhhsjs

3 years ago

Hey Plauntie, I've a question! A lot of mutuals I've got here are saying that asexuals aren't really LGBT+ if they're cis/het and that pan people are biphobic. I don't really understand this so I figured a good person to ask about this is you rather than accept what they're saying at face value since it seems exclusionist to what I thought beforehand.

Well the thing is, ace people aren’t heterosexual. Hererosexuality means sexual attraction to the opposite gender, and the whole thing with acesexuality is that you don’t experience sexual attraction. So that means, by definition, that ace people aren’t heterosexual.

I dunno why that fact is so hard for aphobes to wrap their heads around tbh.

And pan people aren’t biphobic, that’s ridiculous. Bisexual is being attracted to more than one gender. Pansexuality is attraction to people regardless of gender.

Quite honestly, sounds like a lot of your mutuals are kinda shitty excursionists tbh.

4 years ago

@l0stl1am seems like something you’d like to see

Happy Mother’s Day To One Very Tall Mommy!

Happy Mother’s Day to one very tall mommy!

1 year ago

today i overheard a girl say "no, f*ck that. i will be lovely to everyone. maybe some people will remember they have a heart."

4 years ago

anyone else just live for some attention? like “god please someone find me interesting enough to talk to me”??? no just me?

  • scuttlingseaurchin
    scuttlingseaurchin liked this · 8 months ago
  • chemococktailonthehouse
    chemococktailonthehouse liked this · 1 year ago
  • amitybrightlights
    amitybrightlights liked this · 1 year ago
  • justsayinghi5
    justsayinghi5 liked this · 1 year ago
  • ffeneleargasast
    ffeneleargasast liked this · 1 year ago
  • itsmeyakid
    itsmeyakid liked this · 1 year ago
  • rain-runner-x4
    rain-runner-x4 reblogged this · 2 years ago
  • gatorade-brand-deodorant
    gatorade-brand-deodorant reblogged this · 2 years ago
  • myjesst34
    myjesst34 reblogged this · 2 years ago
  • zinogirl
    zinogirl reblogged this · 2 years ago
  • 26904228904
    26904228904 reblogged this · 2 years ago
  • researchgate
    researchgate reblogged this · 2 years ago
  • cripple-cat
    cripple-cat liked this · 2 years ago
  • imnotokay87
    imnotokay87 liked this · 2 years ago
  • electronicpiratemaker
    electronicpiratemaker liked this · 2 years ago
  • deanisatopdom
    deanisatopdom liked this · 2 years ago
  • interestedpasserby
    interestedpasserby liked this · 3 years ago
  • s-t-y-x
    s-t-y-x liked this · 3 years ago
  • thalia-amongst-the-thorns
    thalia-amongst-the-thorns reblogged this · 3 years ago
  • dessartem
    dessartem reblogged this · 3 years ago
  • dessartem
    dessartem liked this · 3 years ago
  • heraexmachina
    heraexmachina reblogged this · 3 years ago
  • chocolatemakerfishscissors
    chocolatemakerfishscissors reblogged this · 3 years ago
  • chocolatemakerfishscissors
    chocolatemakerfishscissors liked this · 3 years ago
quinn-loves-liam - [insert meme here]
[insert meme here]

21, any pronounds really but i prefer they/them or he/him. Proud posessive polyamorous pansexual person.

284 posts

Explore Tumblr Blog
Search Through Tumblr Tags